Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06559

HP ID(1) HP06559
Gene ID(2) 79090
Gene Symbol finder TRAPPC6A
Protein Name trafficking protein particle complex 6A
RefSeq NM_024108.1
Length of RefSeq (bp) 822
Chromosome 19q13.32
Reference DDBJ accession
UniGene Hs.466929

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65C12 pGCAP1 GCGAAGCGCTGGGCGCATCTTTAGGCGTGCGAGGAGGGGGCATGGCGGATACTGTGTTGT
RBb71F11 pGCAP1 AAATGTGGAGGCGTGCGAGGAGGGGGCATGGCGGATACTGTGTTGTTTGAGTTTCTTCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl