Prev. |  KEGG KO K20304 > 

RIKEN DNA Bank Human Resource - TRAPPC6A

Gene ID NCBI Gene 79090 |  KEGG hsa:79090
Gene Symbol TRAPPC6A
Protein Name trafficking protein particle complex 6A
Synonyms TRS33
Ortholog resource in our bank

  TRAPPC6A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083359 IRAL008G15 pOTB7 BC001907 NM_024108
HGY083815 IRAL009I23 pOTB7 BC004450 NM_024108 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097610 M01C044A10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097658 M01C044C10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097706 M01C044E10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097754 M01C044G10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097802 M01C044I10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097850 M01C044K10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097898 M01C044M10 pDONR221 MGC11-F05 BC001907 NM_024108  
HGE097946 M01C044O10 pDONR221 MGC11-F05 BC001907 NM_024108  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346060 RBb65C12 pGCAP1 NM_024108.1  
GCGAAGCGCTGGGCGCATCTTTAGGCGTGCGAGGAGGGGGCATGGCGGATACTGTGTTGT
HKR348531 RBb71F11 pGCAP1 NM_024108.1  
AAATGTGGAGGCGTGCGAGGAGGGGGCATGGCGGATACTGTGTTGTTTGAGTTTCTTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl