Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06558

HP ID(1) HP06558
Gene ID(2) 4867
Gene Symbol finder NPHP1
Protein Name nephronophthisis 1 (juvenile)
RefSeq NM_000272.3
Length of RefSeq (bp) 2758
Chromosome 2q13
Reference DDBJ accession
UniGene Hs.280388

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65B02 pGCAP1 AACTGGAGCAATCAGAGCACCGCAGCCAGGGAGATGCTGGCGAGACGACAGCGAGATCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl