Prev. |  KEGG KO K19657 > 

RIKEN DNA Bank Human Resource - NPHP1

Gene ID NCBI Gene 4867 |  KEGG hsa:4867
Gene Symbol NPHP1
Protein Name nephrocystin 1
Synonyms JBTS4|NPH1|SLSN1
Ortholog resource in our bank

  NPHP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041416 W01A103I24 pENTR-TOPO IRAK135E13 BC062574 NM_000272  
HGE041444 W01A103K04 pENTR-TOPO IRAK135E13 BC062574 NM_000272  
HGE041446 W01A103K06 pENTR-TOPO IRAK135E13 BC062574 NM_000272  
HGE041448 W01A103K08 pENTR-TOPO IRAK135E13 BC062574 NM_000272  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346026 RBb65B02 pGCAP1 NM_000272.3  
AACTGGAGCAATCAGAGCACCGCAGCCAGGGAGATGCTGGCGAGACGACAGCGAGATCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl