Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06552

HP ID(1) HP06552
Gene ID(2) 83590
Gene Symbol finder TMUB1
Protein Name transmembrane and ubiquitin-like domain containing 1
RefSeq NM_031434.3
Length of RefSeq (bp) 1810
Chromosome 7q36.1
Reference DDBJ accession
UniGene Hs.647096

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe85H01 pKA1U5 TGGCCCGAGGGGCCGCGATGGAGCTGGGGGAGCCGGGCGCTCGGTAGCGCGGCGGGCAAG
RBd38E11 pGCAP10 TGGTGCCTGCGACCTCCGCGCCTCCCGCCCGGAAGTGCCCGAGGGGCCGCGATGGAGCTG
RBdS154B12 pGCAP10 GAGGGTTGCTTCAGGTGCCTGCGACCTCCGCGCCTCCCGCCCGGAAGTGCCCGAGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl