Prev. | 

RIKEN DNA Bank Human Resource - TMUB1

Gene ID NCBI Gene 83590 |  KEGG hsa:83590
Gene Symbol TMUB1
Protein Name transmembrane and ubiquitin like domain containing 1
Synonyms C7orf21|DULP|SB144
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097332 IRAL043F12 pOTB7 BC033182 NM_031434

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037352 W01A093G08 pENTR-TOPO IRAK003B12 BC000936 NM_031434  
HGE045889 W01A114M01 pENTR-TOPO IRAK003B12 BC000936 NM_031434  
HGE045891 W01A114M03 pENTR-TOPO IRAK003B12 BC000936 NM_031434  
HGE045895 W01A114M07 pENTR-TOPO IRAK003B12 BC000936 NM_031434  
HGE045897 W01A114M09 pENTR-TOPO IRAK003B12 BC000936 NM_031434  
HGE045899 W01A114M11 pENTR-TOPO IRAK003B12 BC000936 NM_031434  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074169 ARe85H01 pKA1U5 NM_031434.3  
TGGCCCGAGGGGCCGCGATGGAGCTGGGGGAGCCGGGCGCTCGGTAGCGCGGCGGGCAAG
HKR375307 RBd38E11 pGCAP10 NM_031434.3  
TGGTGCCTGCGACCTCCGCGCCTCCCGCCCGGAAGTGCCCGAGGGGCCGCGATGGAGCTG
HKR461636 RBdS154B12 pGCAP10 NM_031434.3  
GAGGGTTGCTTCAGGTGCCTGCGACCTCCGCGCCTCCCGCCCGGAAGTGCCCGAGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl