Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06551

HP ID(1) HP06551
Gene ID(2) 666
Gene Symbol finder BOK
Protein Name BCL2-related ovarian killer
RefSeq NM_032515.3
Length of RefSeq (bp) 2617
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.293753

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe85G05 pKA1U5 GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCG
ARi18D04 pGCAP10 GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCNGGCCCCCGACGCCGCG
ARiS013L22 pGCAP10 GTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCGGCAGGAGCCCCCCAAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl