Prev. |  KEGG KO K02561 > 

RIKEN DNA Bank Human Resource - BOK

Gene ID NCBI Gene 666 |  KEGG hsa:666
Gene Symbol BOK
Protein Name BOK, BCL2 family apoptosis regulator
Synonyms BCL2L9|BOKL
Ortholog resources KEGG ortholog (KEGG orthology K02561) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084555 IRAL011G11 pOTB7 BC006203 NM_032515 Full
HGY086917 IRAL017E21 pOTB7 BC017214 NM_032515 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098010 M01C045A10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098058 M01C045C10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098106 M01C045E10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098154 M01C045G10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098202 M01C045I10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098250 M01C045K10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098298 M01C045M10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098346 M01C045O10 pDONR221 MGC12-B05 BC006203 NM_032515  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074149 ARe85G05 pKA1U5 NM_032515.3  
GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCG
HKR167276 ARi18D04 pGCAP10 NM_032515.3  
GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCNGGCCCCCGACGCCGCG
HKR205486 ARiS013L22 pGCAP10 NM_032515.3  
GTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCGGCAGGAGCCCCCCAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl