Prev. |  KEGG KO K02561 > 

RIKEN DNA Bank Human Resource - BOK

Gene ID NCBI Gene 666 |  KEGG hsa:666
Gene Symbol BOK
Protein Name BCL2 family apoptosis regulator BOK
Synonyms BCL2L9|BOKL
Ortholog resource in our bank

  BOK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084555 IRAL011G11 pOTB7 BC006203 NM_032515 Full
HGY086917 IRAL017E21 pOTB7 BC017214 NM_032515 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098010 M01C045A10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098058 M01C045C10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098106 M01C045E10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098154 M01C045G10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098202 M01C045I10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098250 M01C045K10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098298 M01C045M10 pDONR221 MGC12-B05 BC006203 NM_032515  
HGE098346 M01C045O10 pDONR221 MGC12-B05 BC006203 NM_032515  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074149 ARe85G05 pKA1U5 NM_032515.3  
GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCG
HKR167276 ARi18D04 pGCAP10 NM_032515.3  
GCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCNGGCCCCCGACGCCGCG
HKR205486 ARiS013L22 pGCAP10 NM_032515.3  
GTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCCGCGGCAGGAGCCCCCCAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl