Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06544

HP ID(1) HP06544
Gene ID(2) 140609
Gene Symbol finder NEK7
Protein Name NIMA (never in mitosis gene a)-related kinase 7
RefSeq NM_133494.2
Length of RefSeq (bp) 4143
Chromosome 1q31.3
Reference DDBJ accession
UniGene Hs.24119

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe80G04 pKA1U5 TGGGAGGAGGATCGGGAGTCGCGGGAGGATGGGCCGCCGCTAGGCTCGCACTCCGGACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl