RIKEN DNA Bank Human Resource

DNA Bank Top | KEGG KO K20876 >

RIKEN DNA Bank Human Resource - NEK7

Gene ID	NCBI Gene 140609 \| KEGG hsa:140609
Gene Symbol	NEK7
Protein Name	NIMA related kinase 7
Synonyms	-

Link

Ortholog resource in our bank

NEK7

External database

human NEK7

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB15165	pcDNA3-hNEK7	Expression vector of human NIMA related kinase 7 (NEK7), HA-tag.

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR072148	ARe80G04	pKA1U5	NM_133494.3	full/var
HKR072148	TGGGAGGAGGATCGGGAGTCGCGGGAGGATGGGCCGCCGCTAGGCTCGCACTCCGGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl