Prev. |  KEGG KO K20876 > 

RIKEN DNA Bank Human Resource - NEK7

Gene ID NCBI Gene 140609 |  KEGG hsa:140609
Gene Symbol NEK7
Protein Name NIMA related kinase 7
Synonyms -
Ortholog resource in our bank

  NEK7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15165 pcDNA3-hNEK7 Expression vector of human NIMA related kinase 7 (NEK7), HA-tag.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072148 ARe80G04 pKA1U5 NM_133494.2 done
TGGGAGGAGGATCGGGAGTCGCGGGAGGATGGGCCGCCGCTAGGCTCGCACTCCGGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl