Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06536

HP ID(1) HP06536
Gene ID(2) 51133
Gene Symbol finder KCTD3
Protein Name potassium channel tetramerisation domain containing 3
RefSeq NM_016121.3
Length of RefSeq (bp) 3946
Chromosome 1q41
Reference DDBJ accession
UniGene Hs.335139

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe84F08 pKA1U5 GGAGGAGGAACGAAATGGAATCCCGCGTGGGCAGGCGGCTGGCCAGGAGCACATTCCCCT
ARiS198J06 pGCAP10 AGTTTTTTTTTTTAAGTGAATCCAAGTTTATTAAGAAAGTAAAGGAATAAAAGAATGGCT
RBdS022P05 pGCAP10 GGGAGAAGAGGCCCGGGCGGCCCGGCNNNNNNGANGNNNNAAANNNGCNCANNNNTTTTT
RBdS156J01 pGCAP10 GACGGAGAAGAGGCCCGGGCGGCCCGGNGANNTGNAACCNNNGGGGNNGGTNNTNTANGN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl