Prev. | 

RIKEN DNA Bank Human Resource - KCTD3

Gene ID NCBI Gene 51133 |  KEGG hsa:51133
Gene Symbol KCTD3
Protein Name potassium channel tetramerization domain containing 3
Synonyms NY-REN-45
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085662 IRAL014C14 pOTB7 BC013868 NM_016121 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073728 ARe84F08 pKA1U5 NM_016121.3  
GGAGGAGGAACGAAATGGAATCCCGCGTGGGCAGGCGGCTGGCCAGGAGCACATTCCCCT
HKR279422 ARiS198J06 pGCAP10 NM_016121.3  
AGTTTTTTTTTTTAAGTGAATCCAAGTTTATTAAGAAAGTAAAGGAATAAAAGAATGGCT
HKR409165 RBdS022P05 pGCAP10 NM_016121.3  
GGGAGAAGAGGCCCGGGCGGCCCGGCNNNNNNGANGNNNNAAANNNGCNCANNNNTTTTT
HKR462617 RBdS156J01 pGCAP10 NM_016121.3  
GACGGAGAAGAGGCCCGGGCGGCCCGGNGANNTGNAACCNNNGGGGNNGGTNNTNTANGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl