Prev. | NRCD Clone G | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06531

HP ID(1) HP06531
Gene ID(2) 2776
Gene Symbol finder GNAQ
Protein Name guanine nucleotide binding protein (G protein), q polypeptide
RefSeq NM_002072.2
Length of RefSeq (bp) 2188
Chromosome 9q21
Reference DDBJ accession
UniGene Hs.269782

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe83D05 pKA1U5 GAGGGCCGAGGGCGCCCGGGAGCCGTGTCAGGCGGCGGCGAGGAGCGGGCGCGCCGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl