Prev. |  KEGG KO K04634 > 

RIKEN DNA Bank Human Resource - GNAQ

Gene ID NCBI Gene 2776 |  KEGG hsa:2776
Gene Symbol GNAQ
Protein Name G protein subunit alpha q
Synonyms CMC1|G-ALPHA-q|GAQ|SWS
Featured content Sphingolipid signaling pathway (human)
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  GNAQ

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021979 W01A054P19 pENTR-TOPO IRAK133C21 BC057777 NM_002072 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073277 ARe83D05 pKA1U5 NM_002072.2 Full done
GAGGGCCGAGGGCGCCCGGGAGCCGTGTCAGGCGGCGGCGAGGAGCGGGCGCGCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl