Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06528

HP ID(1) HP06528
Gene ID(2) 7984
Gene Symbol finder ARHGEF5
Protein Name Rho guanine nucleotide exchange factor (GEF) 5
RefSeq NM_005435.3
Length of RefSeq (bp) 5505
Chromosome 7q33-q35
Reference DDBJ accession
UniGene Hs.334

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82G06 pKA1U5 GGATCCCTCCCTCCCGTCGGGCGGCCAGGGGCGGGCCGCGGGTGGGGCGGCCGGGCCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl