Prev. |  KEGG KO K20684 > 

RIKEN DNA Bank Human Resource - ARHGEF5

Gene ID NCBI Gene 7984 |  KEGG hsa:7984
Gene Symbol ARHGEF5
Protein Name Rho guanine nucleotide exchange factor 5
Synonyms GEF5|P60|TIM|TIM1
Ortholog resources KEGG ortholog (KEGG orthology K20684) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072950 ARe82G06 pKA1U5 NM_005435.3 done
GGATCCCTCCCTCCCGTCGGGCGGCCAGGGGCGGGCCGCGGGTGGGGCGGCCGGGCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl