Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06523

HP ID(1) HP06523
Gene ID(2) 6018
Gene Symbol finder RLF
Protein Name rearranged L-myc fusion
RefSeq NM_012421.3
Length of RefSeq (bp) 6266
Chromosome 1p32
Reference DDBJ accession
UniGene Hs.205627

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82C04 pKA1U5 GGCTGGTGGGCCGTGGGAAGATGGCGGACGGAAAGGGAGACGCCGCCGCTGTCGCCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl