Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06511

HP ID(1) HP06511
Gene ID(2) 5770
Gene Symbol finder PTPN1
Protein Name protein tyrosine phosphatase, non-receptor type 1
RefSeq NM_002827.2
Length of RefSeq (bp) 3318
Chromosome 20q13.1-q13.2
Reference DDBJ accession
UniGene Hs.417549

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe81A06 pKA1U5 GGAAGAAGCAGCAGCGGCTAGGGCGGCGGTAGCTGCTNGGGTCGGGGATTGCAGCGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl