Prev. |  KEGG KO K05696 > 

RIKEN DNA Bank Human Resource - PTPN1

Gene ID NCBI Gene 5770 |  KEGG hsa:5770
Gene Symbol PTPN1
Protein Name protein tyrosine phosphatase non-receptor type 1
Synonyms PTP1B
Ortholog resource in our bank

  PTPN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02279 pAxCAhOSF-1 (forward) Shuttle vector to produce rAd expressing human OSF-1
RDB02280 pAxCAhOSF-1 (reverse) Shuttle vector to produce rAd expressing human OSF-1
RDB05493 pKM2L-phPTP1B Promoter Bank clone, Human protein tyrosine phosphatase 1B (PTP1B) promoter
RDB05852 pAxit-phPTP1B-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05853 pAxit-phPTP1B-rLuc (R) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05909 pKM2L-phPTP1B(2) Promoter Bank clone, Human protein tyrosine phosphatase 1B (PTP1B) promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093554 IRAL033O18 pOTB7 BC015660 NM_002827 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072406 ARe81A06 pKA1U5 NM_002827.2  
GGAAGAAGCAGCAGCGGCTAGGGCGGCGGTAGCTGCTNGGGTCGGGGATTGCAGCGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl