Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06509

HP ID(1) HP06509
Gene ID(2) 78992
Gene Symbol finder YIPF2
Protein Name Yip1 domain family, member 2
RefSeq NM_024029.3
Length of RefSeq (bp) 1554
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.323213

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe79H02 pKA1U5 GGAGACGCGCAGGCGCAGAGAGCCCCAGCCACGCCGGCCCAGGTGGCCTCAGGTGAGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl