Prev. | 

RIKEN DNA Bank Human Resource - YIPF2

Gene ID NCBI Gene 78992 |  KEGG hsa:78992
Gene Symbol YIPF2
Protein Name Yip1 domain family member 2
Synonyms FinGER2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082802 IRAL007A02 pOTB7 BC000056 NM_024029 Full
HGY084157 IRAL010G13 pOTB7 BC013014 NM_024029

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097243 M01C043B19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097291 M01C043D19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097339 M01C043F19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097387 M01C043H19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097435 M01C043J19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097483 M01C043L19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097531 M01C043N19 pDONR221 MGC11-C10 BC000056 ENST00000253031  
HGE097579 M01C043P19 pDONR221 MGC11-C10 BC000056 ENST00000253031  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071770 ARe79H02 pKA1U5 NM_024029.3  
GGAGACGCGCAGGCGCAGAGAGCCCCAGCCACGCCGGCCCAGGTGGCCTCAGGTGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl