Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06506

HP ID(1) HP06506
Gene ID(2) 79446
Gene Symbol finder WDR25
Protein Name WD repeat domain 25
RefSeq NM_024515.3
Length of RefSeq (bp) 2004
Chromosome 14q32.2
Reference DDBJ accession
UniGene Hs.497600

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe79D04 pKA1U5 GAGTGTGCTGGCCGGTCTGCCTCCGGGAGAACCGAGCGCTTCCGGTGGTTTGGCTTTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl