Prev. | 

RIKEN DNA Bank Human Resource - WDR25

Gene ID NCBI Gene 79446 |  KEGG hsa:79446
Gene Symbol WDR25
Protein Name WD repeat domain 25
Synonyms C14orf67
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084511 IRAL011E15 pOTB7 BC003641 NM_024515 Partial/var
HGY088284 IRAL020L20 pOTB7 BC007953 NM_024515 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE106833 M01C067B09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE106881 M01C067D09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE106929 M01C067F09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE106977 M01C067H09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE107025 M01C067J09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE107073 M01C067L09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE107121 M01C067N09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  
HGE107169 M01C067P09 pDONR221 06_08-C05 BX248767 (5' CS0DD009YE24)  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071676 ARe79D04 pKA1U5 NM_024515.3  
GAGTGTGCTGGCCGGTCTGCCTCCGGGAGAACCGAGCGCTTCCGGTGGTTTGGCTTTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl