Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06497

HP ID(1) HP06497
Gene ID(2) 93129
Gene Symbol finder ORAI3
Protein Name ORAI calcium release-activated calcium modulator 3
RefSeq NM_152288.2
Length of RefSeq (bp) 2205
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.460617

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe78A11 pKA1U5 GAGTTCCTGTTTTGGCCTCCGCTGTCCCGCTCCGGCTCCTGGGGCTCCCCGCAGACGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl