Prev. |  KEGG KO K16058 > 

RIKEN DNA Bank Human Resource - ORAI3

Gene ID NCBI Gene 93129 |  KEGG hsa:93129
Gene Symbol ORAI3
Protein Name ORAI calcium release-activated calcium modulator 3
Synonyms TMEM142C
Ortholog resources KEGG ortholog (KEGG orthology K16058) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005627 IRAK014B03 pCMV-SPORT6 BC015555 NM_152288
HGY087325 IRAL018F05 pOTB7 BC022786 NM_152288 Full
HGY087331 IRAL018F11 pOTB7 BC006126 NM_152288 Full
HGY087414 IRAL018I22 pOTB7 BC016150 NM_152288 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071211 ARe78A11 pKA1U5 NM_152288.2  
GAGTTCCTGTTTTGGCCTCCGCTGTCCCGCTCCGGCTCCTGGGGCTCCCCGCAGACGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl