Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06485

HP ID(1) HP06485
Gene ID(2) 5792
Gene Symbol finder PTPRF
Protein Name protein tyrosine phosphatase, receptor type, F
RefSeq NM_002840.3
Length of RefSeq (bp) 7733
Chromosome 1p34
Reference DDBJ accession
UniGene Hs.272062

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe76H09 pKA1U5 GGGCAGAGGCGGCGGCTCCAGCTTCGGCTCCCCCNTTAANNACGGGCTCCGGCTCCGGCT
ARi56B06 pGCAP10 TGAGAGGCGGCGGCTCCAGCTTCGGCTCCGGCTCGGGCTCGGGCTCCGGCTCCGGCTCCG
RBdS187H13 pGCAP10 TGGCGGCTGGAGCTGGCGCGGGAGCGGCGGGAGCGGTGGCGGCGGCAGAGGCGGCGGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl