Prev. |  KEGG KO K05695 > 

RIKEN DNA Bank Human Resource - PTPRF

Gene ID NCBI Gene 5792 |  KEGG hsa:5792
Gene Symbol PTPRF
Protein Name protein tyrosine phosphatase, receptor type F
Synonyms BNAH2|LAR
Ortholog resources KEGG ortholog (KEGG orthology K05695) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032922 IRAK082F02 pCMV-SPORT6 BC048768 NM_130440 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070577 ARe76H09 pKA1U5 NM_002840.3  
GGGCAGAGGCGGCGGCTCCAGCTTCGGCTCCCCCNTTAANNACGGGCTCCGGCTCCGGCT
HKR182430 ARi56B06 pGCAP10 NM_002840.3  
TGAGAGGCGGCGGCTCCAGCTTCGGCTCCGGCTCGGGCTCGGGCTCCGGCTCCGGCTCCG
HKR474981 RBdS187H13 pGCAP10 NM_002840.3  
TGGCGGCTGGAGCTGGCGCGGGAGCGGCGGGAGCGGTGGCGGCGGCAGAGGCGGCGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl