Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06471

HP ID(1) HP06471
Gene ID(2) 79159
Gene Symbol finder NOL12
Protein Name nucleolar protein 12
RefSeq NM_024313.2
Length of RefSeq (bp) 2840
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.632778

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe74G11 pKA1U5 GGCTACACCCGGAAGTGTCTTCAGGGAGAGGAAGCCGGCGGCCTCACTGCTATGGGCCGC
RBdS177L07 pGCAP10 GGCTACACCCGGAAGTGTCTTCAGGGAGAGGAAGCCGGCGGCCTCACTGCTATGGGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl