Prev. |  KEGG KO K14851 > 

RIKEN DNA Bank Human Resource - NOL12

Gene ID NCBI Gene 79159 |  KEGG hsa:79159
Gene Symbol NOL12
Protein Name nucleolar protein 12
Synonyms Nop25|dJ37E16.7
Ortholog resource in our bank

  NOL12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084876 IRAL012D04 pOTB7 BC002808 NM_024313 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069755 ARe74G11 pKA1U5 NM_024313.2  
GGCTACACCCGGAAGTGTCTTCAGGGAGAGGAAGCCGGCGGCCTCACTGCTATGGGCCGC
HKR471071 RBdS177L07 pGCAP10 NM_024313.2  
GGCTACACCCGGAAGTGTCTTCAGGGAGAGGAAGCCGGCGGCCTCACTGCTATGGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl