Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06454

HP ID(1) HP06454
Gene ID(2) 5236
Gene Symbol finder PGM1
Protein Name phosphoglucomutase 1
RefSeq NM_002633.2
Length of RefSeq (bp) 2487
Chromosome 1p31
Reference DDBJ accession
UniGene Hs.1869

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe71D07 pKA1U5 GACCCCAGAGCAGCTGCAGCCTCAGCCGGCCGCCCCTCCGCCAGCCAAGTCCGCCGCTCT
ARiS049E19 pGCAP10 GAAGGAGGAGGGCCAAACGCCGGCCTAGAGTGCGGCGTAGCCCCCACCCGCCGTGCCCTC
ARiS122D13 pGCAP10 GGCCGCTCTGACCCCCGGCAGCAAGTCGCCACCATGGTGAAGATCGTGACAGTTAAGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl