Prev. |  KEGG KO K01835 > 

RIKEN DNA Bank Human Resource - PGM1

Gene ID NCBI Gene 5236 |  KEGG hsa:5236
Gene Symbol PGM1
Protein Name phosphoglucomutase 1
Synonyms CDG1T|GSD14
Ortholog resources KEGG ortholog (KEGG orthology K01835) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017130 IRAK042N18 pCMV-SPORT6 BC019920 NM_002633
HGY067242 IRAK168B18 pBluescriptR BC067763 NM_002633 Full/var
HGY082835 IRAL007B11 pOTB7 BC001756 NM_002633 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068479 ARe71D07 pKA1U5 NM_002633.2  
GACCCCAGAGCAGCTGCAGCCTCAGCCGGCCGCCCCTCCGCCAGCCAAGTCCGCCGCTCT
HKR219715 ARiS049E19 pGCAP10 NM_002633.2  
GAAGGAGGAGGGCCAAACGCCGGCCTAGAGTGCGGCGTAGCCCCCACCCGCCGTGCCCTC
HKR248885 ARiS122D13 pGCAP10 NM_002633.2  
GGCCGCTCTGACCCCCGGCAGCAAGTCGCCACCATGGTGAAGATCGTGACAGTTAAGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl