Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06443

HP ID(1) HP06443
Gene ID(2) 378884
Gene Symbol finder NHLRC1
Protein Name NHL repeat containing 1
RefSeq NM_198586.2
Length of RefSeq (bp) 2134
Chromosome 6p22.3
Reference DDBJ accession
UniGene Hs.348351

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70F06 pKA1U5 GGGGAGTGCACAGGACGCGCCATGGCGGCCGAANCCTCGGAGAGCGGGCCAGCGCTGCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl