Prev. |  KEGG KO K10602 > 

RIKEN DNA Bank Human Resource - NHLRC1

Gene ID NCBI Gene 378884 |  KEGG hsa:378884
Gene Symbol NHLRC1
Protein Name NHL repeat containing E3 ubiquitin protein ligase 1
Synonyms EPM2A|EPM2B|MALIN|bA204B7.2
Ortholog resource in our bank

  NHLRC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068126 ARe70F06 pKA1U5 NM_198586.3 full done
GGGGAGTGCACAGGACGCGCCATGGCGGCCGAANCCTCGGAGAGCGGGCCAGCGCTGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl