Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NHLRC1

Gene ID (NCBI) 378884
Gene Symbol NHLRC1
Protein Name NHL repeat containing E3 ubiquitin protein ligase 1
Synonyms EPM2A|EPM2B|MALIN|bA204B7.2
Databases KEGG hsa:378884 |  NCBI Gene 378884
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10602)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068126 ARe70F06 pKA1U5 NM_198586.2  
GGGGAGTGCACAGGACGCGCCATGGCGGCCGAANCCTCGGAGAGCGGGCCAGCGCTGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl