Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06439

HP ID(1) HP06439
Gene ID(2) 79134
Gene Symbol finder TMEM185B
Protein Name transmembrane protein 185B (pseudogene)
RefSeq NR_000034.1
Length of RefSeq (bp) 2131
Chromosome 2q14.2
Reference DDBJ accession
UniGene Hs.376722

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70C01 pKA1U5 ATGTTCCCGGAGTCGCCTGGAAGCGTCCGCCCAAGGTTCGCGGGCCGCTTGGGGAGTCAG
ARe80D03 pKA1U5 GACTCCCGCCTCCATGTTCCCGGAGTCGCCTGGAAGCGTCCGCCCAAGGTCGCGGGCCGC
RBd20F02 pGCAP10 GGTCGCCTGGAAGCGTCCGCCCAAGGTCGCGGGCCGCTTGGGGAGTCAGCAGCGCGCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl