Prev. | 

RIKEN DNA Bank Human Resource - TMEM185B

Gene ID NCBI Gene 79134 |  KEGG hsa:79134
Gene Symbol TMEM185B
Protein Name transmembrane protein 185B
Synonyms FAM11B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103750 IRAL059G06 pOTB7 BC080607 NR_000034

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068049 ARe70C01 pKA1U5 NR_000034.1  
ATGTTCCCGGAGTCGCCTGGAAGCGTCCGCCCAAGGTTCGCGGGCCGCTTGGGGAGTCAG
HKR072075 ARe80D03 pKA1U5 NR_000034.1  
GACTCCCGCCTCCATGTTCCCGGAGTCGCCTGGAAGCGTCCGCCCAAGGTCGCGGGCCGC
HKR368122 RBd20F02 pGCAP10 NR_000034.1  
GGTCGCCTGGAAGCGTCCGCCCAAGGTCGCGGGCCGCTTGGGGAGTCAGCAGCGCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl