Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06426

HP ID(1) HP06426
Gene ID(2) 64149
Gene Symbol finder C17orf75
Protein Name chromosome 17 open reading frame 75
RefSeq NM_022344.2
Length of RefSeq (bp) 1631
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.655257

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04F11 pGCAP10 GAGAGGCCGCCGCAATGCTCCCCTCTTTGCAGGAGTCGATGGATGGAGATGAAAAGGAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl