Prev. | 

RIKEN DNA Bank Human Resource - C17orf75

Gene ID NCBI Gene 64149 |  KEGG hsa:64149
Gene Symbol C17orf75
Protein Name chromosome 17 open reading frame 75
Synonyms NJMU-R1|SRI2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031706 IRAK079E10 pCMV-SPORT6 BC035715 NM_022344 Full
HGX047876 IRAK119L12 pCMV-SPORT6 BC054035 NM_022344 Full
HGY084451 IRAL011C03 pOTB7 BC026017 NM_022344 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161731 ARi04F11 pGCAP10 NM_022344.2  
GAGAGGCCGCCGCAATGCTCCCCTCTTTGCAGGAGTCGATGGATGGAGATGAAAAGGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl