Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06418

HP ID(1) HP06418
Gene ID(2) 9246
Gene Symbol finder UBE2L6
Protein Name ubiquitin-conjugating enzyme E2L 6
RefSeq NM_004223.3
Length of RefSeq (bp) 1260
Chromosome 11q12
Reference DDBJ accession
UniGene Hs.425777

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi03E09 pGCAP10 GACGGGTGCCACACACTCGGTCCCGACATGATGGCGAGCATGCGAGTGGTGAAGGAGCTG
ARi16B04 pGCAP10 GGCTCGGNCCCNGCTGGANGCCACGGGNGCCACACACTCGGTCCCGACATGANGGCGAGC
ARi60C09 pGCAP10 GACTCGGTCCCGACATGATGGCGAGCATGCGAGTGGTGAAGGAGCTGGAGGATCTTCAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl