Prev. |  KEGG KO K04553 > 

RIKEN DNA Bank Human Resource - UBE2L6

Gene ID NCBI Gene 9246 |  KEGG hsa:9246
Gene Symbol UBE2L6
Protein Name ubiquitin conjugating enzyme E2 L6
Synonyms RIG-B|UBCH8
Featured content Parkinson disease - human
Ortholog resource in our bank

  UBE2L6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025976 IRAK064P16 pCMV-SPORT6 BC032491 NM_198183 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE083207 M01C008A07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083255 M01C008C07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083303 M01C008E07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083351 M01C008G07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083399 M01C008I07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083447 M01C008K07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083495 M01C008M07 pDONR221 FLJ01-E04 AK129621 NM_198183  
HGE083543 M01C008O07 pDONR221 FLJ01-E04 AK129621 NM_198183  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161305 ARi03E09 pGCAP10 NM_004223.3  
GACGGGTGCCACACACTCGGTCCCGACATGATGGCGAGCATGCGAGTGGTGAAGGAGCTG
HKR166428 ARi16B04 pGCAP10 NM_004223.3  
GGCTCGGNCCCNGCTGGANGCCACGGGNGCCACACACTCGGTCCCGACATGANGGCGAGC
HKR184057 ARi60C09 pGCAP10 NM_004223.3  
GACTCGGTCCCGACATGATGGCGAGCATGCGAGTGGTGAAGGAGCTGGAGGATCTTCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl