Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06411

HP ID(1) HP06411
Gene ID(2) 8078
Gene Symbol finder USP5
Protein Name ubiquitin specific protease 5 (isopeptidase T)
RefSeq NM_003481.2
Length of RefSeq (bp) 3130
Chromosome 12p13
Reference DDBJ accession
UniGene Hs.631661

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi31C03 pGCAP10 GGGGAGCCGCCGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCTGAGTGAGGAGG
ARi34A10 pGCAP10 GGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCTGAGTGAGGAGGCGCTGCTGTC
ARiS088F18 pGCAP10 GGGTGTCATGGCGGAGCTGAGTGAGGAGGCGCTGCTGTCAGTATTACCGACGATCCGGGT
RBb63H11 pGCAP1 AAATGTGTGGGTGGGAGCCGCCGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl