Prev. |  KEGG KO K11836 > 

RIKEN DNA Bank Human Resource - USP5

Gene ID NCBI Gene 8078 |  KEGG hsa:8078
Gene Symbol USP5
Protein Name ubiquitin specific peptidase 5
Synonyms ISOT
Ortholog resource in our bank

  USP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082906 IRAL007E10 pOTB7 BC005139 NM_003481 Full/var
HGY085688 IRAL014D16 pOTB7 BC004889 NM_003481 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172451 ARi31C03 pGCAP10 NM_003481.2  
GGGGAGCCGCCGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCTGAGTGAGGAGG
HKR173610 ARi34A10 pGCAP10 NM_003481.2  
GGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCTGAGTGAGGAGGCGCTGCTGTC
HKR235338 ARiS088F18 pGCAP10 NM_003481.2  
GGGTGTCATGGCGGAGCTGAGTGAGGAGGCGCTGCTGTCAGTATTACCGACGATCCGGGT
HKR345379 RBb63H11 pGCAP1 NM_003481.2  
AAATGTGTGGGTGGGAGCCGCCGTGTGTGGAGAAGCTGCTGCCGGTGTCATGGCGGAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl