Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06408

HP ID(1) HP06408
Gene ID(2) 23203
Gene Symbol finder PMPCA
Protein Name peptidase (mitochondrial processing) alpha
RefSeq NM_015160.1
Length of RefSeq (bp) 2097
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.495471

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb63D05 pGCAP1 GGAAGCGGGGCGGAGACGCAAGATGGCGGCTGTGGTGCTGGCGGCGACGCGGTTGCTGCG
RBdS105O03 pGCAP10 GGGAGACGCAAGATGGCGGCTGTGGTGCTGGCGGCGACGCGGTTGCTGCGGGGCTCGGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl