Prev. |  KEGG KO K01412 > 

RIKEN DNA Bank Human Resource - PMPCA

Gene ID NCBI Gene 23203 |  KEGG hsa:23203
Gene Symbol PMPCA
Protein Name peptidase, mitochondrial processing alpha subunit
Synonyms Alpha-MPP|CLA1|CPD3|INPP5E|P-55|SCAR2
Ortholog resources KEGG ortholog (KEGG orthology K01412) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008423 IRAK021A23 pCMV-SPORT6 BC022949 NM_015160 Partial/var
HGY085366 IRAL013G22 pOTB7 BC004342 NM_015160 Partial
HGY097431 IRAL043J15 pOTB7 BC033103 NM_015160

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081614 M01C004A14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081662 M01C004C14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081710 M01C004E14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081758 M01C004G14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081806 M01C004I14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081854 M01C004K14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081902 M01C004M14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE081950 M01C004O14 pDONR221 04-134-2_2-F07 BC033103 NM_015160  
HGE100840 M01C052B16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE100888 M01C052D16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE100936 M01C052F16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE100984 M01C052H16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE101032 M01C052J16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE101080 M01C052L16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE101128 M01C052N16 pDONR221 MGC15-H08 BC033103 NM_015160  
HGE101176 M01C052P16 pDONR221 MGC15-H08 BC033103 NM_015160  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR345277 RBb63D05 pGCAP1 NM_015160.1  
GGAAGCGGGGCGGAGACGCAAGATGGCGGCTGTGGTGCTGGCGGCGACGCGGTTGCTGCG
HKR442339 RBdS105O03 pGCAP10 NM_015160.1  
GGGAGACGCAAGATGGCGGCTGTGGTGCTGGCGGCGACGCGGTTGCTGCGGGGCTCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl