Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06398

HP ID(1) HP06398
Gene ID(2) 6051
Gene Symbol finder RNPEP
Protein Name arginyl aminopeptidase (aminopeptidase B)
RefSeq NM_020216.3
Length of RefSeq (bp) 2430
Chromosome 1q32
Reference DDBJ accession
UniGene Hs.497391

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe99D07 pKA1U5 ATCCTGGGAGCAACGGCTCTGCGGCCATGGCGAGCGGCGAGCATTCCCCCGGCAGCGGCG
ARiS087O24 pGCAP10 TGAGCAACGGCTCTGCGGCCATGGCGAGCGGCGAGCATTCCCCCGGCAGCGGCGCGGCCC
RBb60D02 pGCAP1 GGCACTCCGCGCAGGCTGTGGACGTGGCCTCGGCCTCCAACTTCCGGGCCTTTGAGCTGC
RBd10F05 pGCAP10 GATTCCCCCGGCAGCGGCGCGGCCCGGCGGCCGCTGCACTCCGCGCAGGCTGTGGACGTG
RBd18A03 pGCAP10 GAGAGCAACGGCTCTGCGGCCATGGCGAGCGGCGAGCATTCCCCCGGCAGCGGCGCGGCC
RBd97D07 pGCAP10 GGCGGCGCTCGGGGCGGGGCTCCCCTCGGGTTCGCGGCCCGGCCGGTGAGCAACGGCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl