Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06392

HP ID(1) HP06392
Gene ID(2) 124602
Gene Symbol finder KIF19
Protein Name kinesin family member 19
RefSeq NM_153209.3
Length of RefSeq (bp) 3670
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.372773

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb59F11 pGCAP1 TGGGAGGCGGCGGGCAGCTAGCAGCTGGCGGACGCGACCCGGAGGCGGTGGGGGTGCGGC
RBdS007L22 pGCAP10 GGTCAGGCAGCGCGCGAGGCGGCGGGCAGCTAGCAGCTGGCGGACGCGACCCGGAGGCGG
RBdS075D22 pGCAP10 GGGGTCGGCGTCCTTAGCCGCTGGCGCGTTGTTGGTTTCGGGTTGTCAGGCAGCGCGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl