Prev. |  KEGG KO K10401 > 

RIKEN DNA Bank Human Resource - KIF19

Gene ID NCBI Gene 124602 |  KEGG hsa:124602
Gene Symbol KIF19
Protein Name kinesin family member 19
Synonyms KIF19A
Ortholog resource in our bank

  KIF19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007779 W01A019H11 pENTR-TOPO flj0022c24 AK094619 NM_153209  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR343731 RBb59F11 pGCAP1 NM_153209.3 done
TGGGAGGCGGCGGGCAGCTAGCAGCTGGCGGACGCGACCCGGAGGCGGTGGGGGTGCGGC
HKR403086 RBdS007L22 pGCAP10 NM_153209.3 done
GGTCAGGCAGCGCGCGAGGCGGCGGGCAGCTAGCAGCTGGCGGACGCGACCCGGAGGCGG
HKR430094 RBdS075D22 pGCAP10 NM_153209.3 done
GGGGTCGGCGTCCTTAGCCGCTGGCGCGTTGTTGGTTTCGGGTTGTCAGGCAGCGCGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl