Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06389

HP ID(1) HP06389
Gene ID(2) 124857
Gene Symbol finder WFIKKN2
Protein Name WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2?
RefSeq NM_175575.5
Length of RefSeq (bp) 3765
Chromosome 17q21.33
Reference DDBJ accession
UniGene Hs.211475

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb59C07 pGCAP1 TGGACAAGTCGCTCGCCCTCTTCGACCACAGACCTTCTCCTTTGGGAAGTGGGGGAGGCC
RBd42A06 pGCAP10 GAGAGGCGCCAGCAGCCTGCCTGTGACAGGCATCAGGTTAGCTGGCTCCCACTCGGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl