Prev. | 

RIKEN DNA Bank Human Resource - WFIKKN2

Gene ID NCBI Gene 124857 |  KEGG hsa:124857
Gene Symbol WFIKKN2
Protein Name WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms GASP-1|WFDC20B|WFIKKNRP|hGASP-1
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR343655 RBb59C07 pGCAP1 NM_175575.5  
TGGACAAGTCGCTCGCCCTCTTCGACCACAGACCTTCTCCTTTGGGAAGTGGGGGAGGCC
HKR376806 RBd42A06 pGCAP10 NM_175575.5  
GAGAGGCGCCAGCAGCCTGCCTGTGACAGGCATCAGGTTAGCTGGCTCCCACTCGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl