Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06385

HP ID(1) HP06385
Gene ID(2) 889
Gene Symbol finder KRIT1
Protein Name KRIT1, ankyrin repeat containing
RefSeq NM_001013406.1
Length of RefSeq (bp) 4231
Chromosome 7q21-q22
Reference DDBJ accession
UniGene Hs.531987

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh12H01 pGCAP1 GATTTCATAGCCACGGTAACGGCGGGGTGGAAAGCTAAGGCCTTTGAAGACCTGGGACCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl