Prev. |  KEGG KO K17705 > 

RIKEN DNA Bank Human Resource - KRIT1

Gene ID NCBI Gene 889 |  KEGG hsa:889
Gene Symbol KRIT1
Protein Name KRIT1 ankyrin repeat containing
Synonyms CAM|CCM1
Ortholog resource in our bank

  KRIT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR124969 ARh12H01 pGCAP1 NM_001013406.1 done
GATTTCATAGCCACGGTAACGGCGGGGTGGAAAGCTAAGGCCTTTGAAGACCTGGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl