RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - KRIT1

Gene ID	NCBI Gene 889 \| KEGG hsa:889
Gene Symbol	KRIT1
Protein Name	KRIT1 ankyrin repeat containing
Synonyms	CAM\|CCM1

Ortholog resource in our bank

  KRIT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR124969	ARh12H01	pGCAP1	NM_001013406.1	Full
HKR124969	GATTTCATAGCCACGGTAACGGCGGGGTGGAAAGCTAAGGCCTTTGAAGACCTGGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl